Candidate microRNAs for Use as Internal Reference Controls in the Development of Liquid Biopsy Assays
2025-11-05
Three independent panels of microRNAs serving as (i) internal reference controls to verify assay performance, (ii) indicators of hemolysis in plasma or serum samples, and (iii) markers of platelet lysis or contamination during pre-analytical handling.
- Expected properties of the miRNA internal reference controls:
- low inter-individual variability;
- present in the general population;
- constitutively occurring in plasma irrespective of conditions and/or environmental factors;
- allow for the detection of a wide range of miRNA analytes/plama
volume;
- Expected properties of the miRNA markers of hemolysis and platelet
lysis controls:
- provide a QC measure of pre-analytical samples processing;
Reports of miRNA in the plasma cell-free compartment in asymptomatic subjects:
cell-free miRNAs have been reported stable and relatively abundant in plasma. (Mitchell et al. 2008)
These circulating miRNAs are assumed to be protected from degradation in plasma through various mechanisms, such as encapsulation within extracellular membrane vesicles (EMVs) or by forming ribonucleoprotein complexes, often associated with proteins like Argonaute 2 (AGO2) or nucleomorphin 1 (NPM1). (Pös et al. 2018) (Arroyo et al. 2011)
miRNAs as cargo on HDL: some miRNAs can also be associated with high-density lipoprotein (HDL), which protects them from RNase activity. (Vickers et al. 2011)
(Mitchell et al. 2008), (Chen et al. 2008) and (Chim et al. 2008) reported the observation and quantification of miRNA in the plasma cell free compartment.
(Arroyo et al. 2011) provided evidence that a significant portion of plasma cf miRNA is bound to proteins, specifically to Ago2, which accounts for their protection from RNAse degradation.
In plasma collected from healthy individuals, the absolute concentrations of three representative endogenous miRNAs (miR-15b, miR-16, and miR-24) were quantified using TaqMan quantitative RT-PCR. The concentrations of these three miRNAs in the plasma of each individual were found to range from 9xE^3 copies per ul plasma to 134xE^3 copies per ul plasma, depending on the specific miRNA examined (Mitchell et al. 2008)
hsa-miR-93-5p was also reported as an additional miRNA internal reference controls (Song et al. 2012)
Levels of cell-free RNAs, including miRNAs, can be influenced by preanalytical processing conditions, quantification strategies, and batch effects, which have sometimes led to a lack of reproducibility and poor specificity for miRNA biomarkers.
hsa-miR-20b-5p, hsa-miR-363-3p, and hsa-miR-451a were identified as hemolysis biomarkers by both (Smith et al. 2022) and (Chan et al. 2023) using contrived hemolyzed samples
Platelet RNAs released during sample prep are one of the main source of technical variability.(Nesselbush et al. 2025). (Chan et al. 2023) reported hsa-miR-1973 and hsa-miR-28-5p while hsa-miR-223-3p is another platelet lysis/activation marker based on (Charlon-Gay et al. 2025). hsa-miR-223-3p is highly abundant in megakaryocyte and platelet lineages.
Data sources:
miRNAs for cfRNA normalization
miRNA_IC <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "IC")
kable(
miRNA_IC[,1:3],
rownames = FALSE,
caption = "Candidate miRNAs for plasma cell-free normalization"
) %>%
kable_styling(
latex_options = c("scale_down", "hold_position"),
full_width = FALSE,
font_size =10
)| miRNA | Rationale | Mature.strand |
|---|---|---|
| hsa-miR-16-5p | One of the most frequently used normalizers in circulating miRNA studies. [Donati et al., 2019] | UAGCAGCACGUAAAUAUUGGCG |
| hsa-miR-93-5p | Reported relatively stable across serum/plasma (Song et al. 2012) and used by Exiqon as a candidate normalize | CAAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-484 | Identified by Exiqon / Thermo Fisher guide as among most stable in plasma / serum | UCAGGCUCUGGGCAACUGGUU |
| hsa-miR-191-5p | Used across multiple tissues and also suggested for serum/plasma normalization (Thermo Fisher guide) | CAACGGAAACGAAUCGUGAUAG |
| hsa-miR-24-3p | Reported by Exiqon as stable in serum panel | UGGCUCAGUGUUCUUCUGGG |
| hsa-miR-126-3p | Included in Exiqon reference guide / panels as a candidate plasma miRNA for normalization (Thermo Fisher) | UCGUACCGUGAGUAAUAAUGCG |
| hsa-miR-30e-5p | Identified in TaqMan guide as a candidate stable miRNA across tissues; sometimes | UGUAAACAUCCUUGACUGGAAG |
Hemolysis miRNAs markers
hemolysisRNActrl <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "hemolysis_markers")
kable(
hemolysisRNActrl,
rownames = FALSE,
caption = "Candidate hemolysis miRNA markers"
) %>%
kable_styling(
latex_options = c("scale_down", "hold_position"),
full_width = FALSE,
font_size =12
)| miRNA | Rationale | Mature.strand |
|---|---|---|
| hsa-miR-451a | Identified as prominent RBC-related biomarkers (Smith et al., 2022) | AAACCGUUACCAUUACUGAGUU |
| hsa-miR-20b-5p | Shkurnikov et al., 2016, Smith et al., 2022, Chan et al, 2023 | CAAAGUGCUCAUAGUGCAGGUAG |
| hsa-miR-363-3p | Shkurnikov et al., 2016, Smith et al., 2022, Chan et al, 2023 | AAUUGCACGGUAUCCAUCUGUA |
Platelet lysis or platelet activation miRNAs markers
hemolysisRNActrl <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "plateletLysis")
kable(
hemolysisRNActrl,
rownames = FALSE,
caption = "Candidate platelet lysis/activation miRNA markers"
) %>%
kable_styling(
latex_options = c("scale_down", "hold_position"),
full_width = FALSE,
font_size =12
)| miRNA | Rationale | Mature.strand |
|---|---|---|
| hsa-miR-1973 | Chan et al, 2023 | ACCGUGCAAAGGUAGCAUA |
| hsa-miR-28-5p | Chan et al, 2023 | AAGGAGCUCACAGUCUAUUGAG |
| hsa-miR-223-3p | Charlon-Gay et al., 2025 | UGUCAGUUUGUCAAAUACCCCA |