Three independent panels of microRNAs serving as (i) internal reference controls to verify assay performance, (ii) indicators of hemolysis in plasma or serum samples, and (iii) markers of platelet lysis or contamination during pre-analytical handling.

  • Expected properties of the miRNA internal reference controls:
    • low inter-individual variability;
    • present in the general population;
    • constitutively occurring in plasma irrespective of conditions and/or environmental factors;
    • allow for the detection of a wide range of miRNA analytes/plama volume;
  • Expected properties of the miRNA markers of hemolysis and platelet lysis controls:
    • provide a QC measure of pre-analytical samples processing;

Reports of miRNA in the plasma cell-free compartment in asymptomatic subjects:

  • cell-free miRNAs have been reported stable and relatively abundant in plasma. (Mitchell et al. 2008)

  • These circulating miRNAs are assumed to be protected from degradation in plasma through various mechanisms, such as encapsulation within extracellular membrane vesicles (EMVs) or by forming ribonucleoprotein complexes, often associated with proteins like Argonaute 2 (AGO2) or nucleomorphin 1 (NPM1). (Pös et al. 2018) (Arroyo et al. 2011)

  • miRNAs as cargo on HDL: some miRNAs can also be associated with high-density lipoprotein (HDL), which protects them from RNase activity. (Vickers et al. 2011)

  • (Mitchell et al. 2008), (Chen et al. 2008) and (Chim et al. 2008) reported the observation and quantification of miRNA in the plasma cell free compartment.

  • (Arroyo et al. 2011) provided evidence that a significant portion of plasma cf miRNA is bound to proteins, specifically to Ago2, which accounts for their protection from RNAse degradation.

  • In plasma collected from healthy individuals, the absolute concentrations of three representative endogenous miRNAs (miR-15b, miR-16, and miR-24) were quantified using TaqMan quantitative RT-PCR. The concentrations of these three miRNAs in the plasma of each individual were found to range from 9xE^3 copies per ul plasma to 134xE^3 copies per ul plasma, depending on the specific miRNA examined (Mitchell et al. 2008)

  • hsa-miR-93-5p was also reported as an additional miRNA internal reference controls (Song et al. 2012)

  • Levels of cell-free RNAs, including miRNAs, can be influenced by preanalytical processing conditions, quantification strategies, and batch effects, which have sometimes led to a lack of reproducibility and poor specificity for miRNA biomarkers.

  • hsa-miR-20b-5p, hsa-miR-363-3p, and hsa-miR-451a were identified as hemolysis biomarkers by both (Smith et al. 2022) and (Chan et al. 2023) using contrived hemolyzed samples

  • Platelet RNAs released during sample prep are one of the main source of technical variability.(Nesselbush et al. 2025). (Chan et al. 2023) reported hsa-miR-1973 and hsa-miR-28-5p while hsa-miR-223-3p is another platelet lysis/activation marker based on (Charlon-Gay et al. 2025). hsa-miR-223-3p is highly abundant in megakaryocyte and platelet lineages.

miRNAs for cfRNA normalization

miRNA_IC  <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "IC") 

kable(
  miRNA_IC[,1:3],
  rownames = FALSE,
  caption = "Candidate miRNAs for plasma cell-free normalization"
) %>% 
  kable_styling(
    latex_options = c("scale_down", "hold_position"),
    full_width = FALSE,
    font_size =10
  )
Candidate miRNAs for plasma cell-free normalization
miRNA Rationale Mature.strand
hsa-miR-16-5p One of the most frequently used normalizers in circulating miRNA studies. [Donati et al., 2019] UAGCAGCACGUAAAUAUUGGCG
hsa-miR-93-5p Reported relatively stable across serum/plasma (Song et al. 2012) and used by Exiqon as a candidate normalize CAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-484 Identified by Exiqon / Thermo Fisher guide as among most stable in plasma / serum UCAGGCUCUGGGCAACUGGUU
hsa-miR-191-5p Used across multiple tissues and also suggested for serum/plasma normalization (Thermo Fisher guide) CAACGGAAACGAAUCGUGAUAG
hsa-miR-24-3p Reported by Exiqon as stable in serum panel UGGCUCAGUGUUCUUCUGGG
hsa-miR-126-3p Included in Exiqon reference guide / panels as a candidate plasma miRNA for normalization (Thermo Fisher) UCGUACCGUGAGUAAUAAUGCG
hsa-miR-30e-5p Identified in TaqMan guide as a candidate stable miRNA across tissues; sometimes UGUAAACAUCCUUGACUGGAAG

Hemolysis miRNAs markers

hemolysisRNActrl  <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "hemolysis_markers") 
 
kable(
  hemolysisRNActrl,
  rownames = FALSE,
  caption = "Candidate hemolysis miRNA markers"
) %>% 
  kable_styling(
    latex_options = c("scale_down", "hold_position"),
    full_width = FALSE,
    font_size =12
  )
Candidate hemolysis miRNA markers
miRNA Rationale Mature.strand
hsa-miR-451a Identified as prominent RBC-related biomarkers (Smith et al., 2022) AAACCGUUACCAUUACUGAGUU
hsa-miR-20b-5p Shkurnikov et al., 2016, Smith et al., 2022, Chan et al, 2023 CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-363-3p Shkurnikov et al., 2016, Smith et al., 2022, Chan et al, 2023 AAUUGCACGGUAUCCAUCUGUA

Platelet lysis or platelet activation miRNAs markers

hemolysisRNActrl  <- openxlsx::read.xlsx("OV/Candidate_miRNAs_for_cfRNA_normalization.xlsx", sheet = "plateletLysis") 

kable(
  hemolysisRNActrl,
  rownames = FALSE,
  caption = "Candidate platelet lysis/activation miRNA markers"
) %>% 
  kable_styling(
    latex_options = c("scale_down", "hold_position"),
    full_width = FALSE,
    font_size =12
  )
Candidate platelet lysis/activation miRNA markers
miRNA Rationale Mature.strand
hsa-miR-1973 Chan et al, 2023 ACCGUGCAAAGGUAGCAUA
hsa-miR-28-5p Chan et al, 2023 AAGGAGCUCACAGUCUAUUGAG
hsa-miR-223-3p Charlon-Gay et al., 2025 UGUCAGUUUGUCAAAUACCCCA

References

Arroyo, Jason D., John R. Chevillet, Evan M. Kroh, Ingrid K. Ruf, Colin C. Pritchard, Donald F. Gibson, Patrick S. Mitchell, et al. 2011. “Argonaute2 Complexes Carry a Population of Circulating microRNAs Independent of Vesicles in Human Plasma.” Proceedings of the National Academy of Sciences of the United States of America 108 (March): 5003–8. https://doi.org/10.1073/PNAS.1019055108/-/DCSUPPLEMENTAL.
Chan, Suit-Fong, He Cheng, Karen Kai-Rui Goh, and Ruiyang Zou. 2023. “Preanalytic Methodological Considerations and Sample Quality Control of Circulating miRNAs.” The Journal of Molecular Diagnostics 25: 438–53. https://doi.org/10.1016/j.jmoldx.2023.03.005.
Charlon-Gay, Julia, Séverine Nolli, Sylvie Dunoyer-Geindre, Paulina Ciepla, Jean-Luc Reny, and Pierre Fontana. 2025. “MicroRNA-223-3p Is a Determinant of Platelet Procoagulant Activity.” Blood Advances, October. https://doi.org/10.1182/BLOODADVANCES.2024015290.
Chen, X., Y. Ba, L. Ma, X. Cai, Y. Yin, K. Wang, J. Guo, et al. 2008. “Characterization of microRNAs in Serum: A Novel Class of Biomarkers for Diagnosis of Cancer and Other Diseases.” Cell Research 18 (10): 997–1006. https://doi.org/10.1038/cr.2008.282.
Chim, S. S., T. K. Shing, E. C. Hung, T. Y. Leung, T. K. Lau, R. W. Chiu, and Y. M. Lo. 2008. “Detection and Characterization of Placental microRNAs in Maternal Plasma.” Clinical Chemistry 54 (3): 482–90. https://doi.org/10.1373/clinchem.2007.103827.
Mitchell, Patrick S., Rachael K. Parkin, Evan M. Kroh, Brian R. Fritz, Stacia K. Wyman, Era L. Pogosova-Agadjanyan, Amelia Peterson, et al. 2008. “Circulating microRNAs as Stable Blood-Based Markers for Cancer Detection.” Proceedings of the National Academy of Sciences of the United States of America 105 (July): 10513–18. https://doi.org/10.1073/PNAS.0804549105.
Nesselbush, Monica C., Bogdan A. Luca, Young-Jun Jeon, Isabel Jabara, Catherine B. Meador, Andrea Garofalo, Michael S. Binkley, et al. 2025. An ultrasensitive method for detection of cell-free RNA.” Nature. https://doi.org/10.1038/s41586-025-08834-1.
Pös, Ondrej, Orsolya Biró, Tomas Szemes, and Bálint Nagy. 2018. Circulating cell-free nucleic acids: characteristics and applications.” Eur. J. Hum. Genet. 26: 937–45. https://doi.org/10.1038/s41431-018-0132-4.
Smith, Melanie D., Shalem Y. Leemaqz, Tanja Jankovic-Karasoulos, Dale McAninch, Dylan McCullough, James Breen, Claire T. Roberts, and Katherine A. Pillman. 2022. “Haemolysis Detection in MicroRNA-Seq from Clinical Plasma Samples.” Genes 13 (July): 1288. https://doi.org/10.3390/GENES13071288/S1.
Song, Jianning, Zhigang Bai, Wei Han, Jun Zhang, Hua Meng, Jintao Bi, Xuemei Ma, Shiwei Han, and Zhongtao Zhang. 2012. “Identification of Suitable Reference Genes for qPCR Analysis of Serum microRNA in Gastric Cancer Patients.” Digestive Diseases and Sciences 57 (April): 897–904. https://doi.org/10.1007/S10620-011-1981-7/METRICS.
Vickers, Kasey C., Brian T. Palmisano, Bassem M. Shoucri, Robert D. Shamburek, and Alan T. Remaley. 2011. “MicroRNAs Are Transported in Plasma and Delivered to Recipient Cells by High-Density Lipoproteins.” Nature Cell Biology 13 (April): 423. https://doi.org/10.1038/NCB2210.